на главную страницу
 > Обзоры > Vector NTI > Дизайн молекул.

Расширенный дизайн молекул.

Игорь Хмельков
Эти же материалы в формате MS Word можно забрать на сайте WETWARE.

    Этот раздел суммирует все те приемы работы, которые мы изучили ранее, работая с Vector NTI. Здесь мы рассмотрим несколько более сложную задачу по клонированию молекул. Мы уже знаем, как выполнить простой дизайн, давайте рассмотрим две более сложные ситуации. Для начала, мы сформулируем некоторые дополнительные условия для молекулы-реципиента, оставив все что касается молекулы донора без изменений. Затем, мы используем сравнительно простой реципиент, а донора сделаем более сложным.

    Не знаю как вы, а я уже устал от pBR322 и pUC19. Давайте сменим молекулы. Теперь мы будем работать с BPV1 и SV40, а наша задача будет состоять в том, чтобы клонировать большой T-cell антиген (LARGE_T) из SV40 в BPV1.

    Итак, задача заключается в клонировании гена LARGE_T из SV40 в BPV1, причем двумя различными способами. Мы должны наложить определенные условия сначала на реципиент, затем на донор, а потом сравнить предложенные Vector NTI инструкции по дизайну молекул.

    Первый вариант: сложный реципиент...

    Для первого варианта задача формулируется следующим образом. Нам необходимо вставить LARGE_T ген из SV40 во второй ApaLI сайт BPV1. Также необходимо, чтобы Vector NTI сохранил на 5’-конце фрагмента ApaLI сайт и запретил клонирование по тупым концам (blunt-blunt).

    Если у донора есть необходимые для вырезания фрагмента сайты ApaLI, задача клонирования будет тривиальной, если же таких сайтов нет, процедура вставки фрагмента в некоторой степени усложнится.

    Определим реципиент...

    Откроем Display window для BPV1 и SV40. Перейдем к BPV1 и сделаем активной графическую панель окна. Вызовем Fragment Wizard, в появившемся окне выберем опцию Design Recipient и нажмем на клавишу Next. Для определения 5’-конца фрагмента кликнем в графической части окна на метке ApaLI #2 (нуклеотид 7631, расположен в районе 11-ти часов). Нажмем на клавишу Next. Следующая панель позволит нам определить судьбу сайта ApaLI на 5’-конце реципиента. Сохраним сайт (выберем опцию Save Site) и снова нажмем на клавишу Next.

    Далее, определим 3’-конец фрагмента. Удерживая в нажатом состоянии клавишу Sift, кликнем снова на том же сайте. Название и позиция сайта отобразятся в соответствующих полях Fragment Wizard. Мы выполнили все необходимое, чтобы определить реципиент-фрагмент. Нажмем на клавишу Finish.

    Определение реципиента

    Проверим параметры выбранного фрагмента в появившемся окне. Заметим, что 3’ и 5’-концы реципиент-фрагмента представляют собой один и тот же сайт ApaLI. Нажмем на клавишу Add to List. Реципиент-фрагмент будет добавлен в список Molecule Goal list.

    Определим донор...

    Перейдем к окну SV40 и активируем графическую часть окна. Вызовем Fragment Wizard и в появившемся окне выберем опцию Design Donor. Нажмем на клавишу Next. Теперь кликнем на символе сигнала LARGE_T или на его метке в графической части окна, информация о сигнале появится на панели Fragment Wizard. Далее, нажмем на клавишу Finish.

    Определение донора

    Уточним описание донор-фрагмента в появившемся окне, и если все нас устраивает, нажмем на клавишу Add to List. Донор-фрагмент будет добавлен в целевой список.

    Посмотрим целевой список...

    Давайте проинспектируем целевой список (Goal molecule Definition List). Для этого нажмем на соответствующую пиктограмму, расположенную на основной панели инструментов программы. В результате откроется диалоговая панель Design Molecule. Список содержит два выбранных нами фрагмента. Убедимся, что реципиент-фрагмент находится вверху списка.

    Изменение ориентации

    Дважды кликнем на фрагменте SV40, появится панель Fragment Editor. Установим флажок "Inverted" для того, чтобы изменить направление LARGE_T в соответствии с направлением реципиента и нажмем на клавишу ОК.

    Мы можем оставить LARGE_T в оригинальной ориентации. Инвертировать LARGE_T следует для того, чтобы посмотреть, как Vector NTI будет клонировать фрагменты различной ориентации.


    Введем общую информацию о новой молекуле...

    Поменяем название молекулы на My molecule 3.Нажмем на клавишу General Info. В поле Description введем "My Molecule 3". Установим тип репликации – "Plasmid" и включим опцию "Bacteria Extra-Chromosome Replication". Установим начало новой молекулы в соответствии с началом молекулы-реципиента (BPV1), для этого включим опцию Recipient’s Start.

    Подготовимся к дизайну...

    Нажмем на клавишу Design в правом верхнем углу панели Design Molecule. Программа попросит нас указать имя базы данных, в которую будет записана информация о новой молекуле. Укажем на базу данных My base, которую мы создали, когда занимались конструированием. Vector NTI сохранит всю необходимую информацию о новой молекуле.

    Далее, появится панель Design Parameters. Оставим все параметры без изменений и перейдем к следующему этапу.

    Установим параметры дизайна...

    Нажмем на клавишу Preferences. Откроется диалоговая панель Design Preferences. Обратим внимание на то, что опция blunt-blunt ligation уже выключена. Это произошло потому, что Vector NTI помнит последние настройки (мы отключили эту опцию, когда работали с pBR322 и pUC19).

    Оставим все параметры в соответствии со значениями по умолчанию и нажмем на клавишу ОК для того, чтобы программа приняла установленные настройки. После этого мы вернемся на диалоговую панель Design Parameters.


    Представление новой молекулы

    Посмотрим, что получилось...

    Теперь все готово для того чтобы приступить собственно к дизайну молекулы. Нажмем на клавишу Start Design. В течении некоторого времени Vector NTI рассмотрит различные варианты клонирования, выберет оптимальный и на его основе построит нашу молекулу.

    Когда процесс будет завершен, программа откроет Molecule Display window для новой молекулы.

    Перейдем к текстовой панели окна и откроем папку Design Description для My Molecule 3. Убедимся, что дизайн был выполнен за одну стадию, т.е. папка Design Description содержит только одну вложенную папку Step#1. В этой папке мы найдем следующую информацию:


    Result Molecule: My Molecule3
    Recipient: BPV1
      Left Terminus: ApaLI #2 (total 2)
      Right Terminus: ApaLI #2 (total 2)
      Partial digestion: 1 sites inside required fragment, 2 sites total
    Donor: SV40 (Complementary)
      Left Terminus: BamHI #1 (total 1)
        Completely filled in
        Modified by linker ApaLI
        Flank Region: 153
      Right Terminus: AvrII #2 (total 2)
        Completely filled in
        Modified by linker ApaLI
        Flank Region: 28
      Full digestion
    Ligation: cohesive termini at both junctions
    Preselection: dephosphorylation
    Transformation system: Bacteria
      Extra-chromosomal replication
    Recommended method(s) for clone analysis:
      Restriction Analysis
    Recommended enzyme(s) for restriction analysis:
      AatI
    Recommended enzyme(s) for restriction analysis
    defining clone with required fragment orientation:
      AvrII
      ApaLI
    Recommended oligonucleotide for colony hybridization
    of cloned fragment in resulting molecule:
      CTAGGCTTTTGCAAAAAGCT
    Recommended primers for PCR amplification
    of cloned fragment in resulting molecule:
      Sense Primer:
        ATGTCTGTACCGCCATCGGTGCAC
      Antisense Primer:
        ACCTATATCGGTGCACGGGG
    Important Restriction Sites:
      Cloned fragment may be cut by AvrII and ApaLI
      Recombinant lacks sites of:
        ApaI AscI BsiWI Bsp120I BssHII Ecl136II
        Eco47III EcoRV KspI MluNI NaeI NgoMI
        NotI PacI PaeR7I PmeI PvuI SacI
        SalI SnaBI SwaI
      Unique sites outside cloned fragment:
        AatII Acc65I AccIII AflII AosI AsuII EagI EcoRI
        KpnI MluI NruI Psp1406I SmaI XbaI XmaI
    	

    Вспомним, что мы определили на молекуле-реципиенте специфический сайт ApaLI как сайт, в который будет клонирован донор-фрагмент, и который мы просили сохранить в рекомбинанте. ApaLI не был уникальным сайтом, поэтому Vector NTI использовал частичное расщепление (partial digestion) для изоляции реципиента. Затем программа нашла путь для вставки донор-фрагмента. Возможно, у донора не было найдено подходящих сайтов для того, чтобы вставить его в сайт ApaLI реципиента. Поэтому Vector NTI вырезал донор-фрагмент с более или менее подходящими сайтами, которые не требовали частичного расщепления и оставил короткие фланкирующие участки (BamHI и AvrII). Эти концы были затем дополнены и к тупым концам были добавлены линкеры для ApaLI. В конце концов, этот фрагмент и был клонирован в реципиент.

    Мы можем быть уверены в том, что клонированный фрагмент не содержит сайтов ApaLI (Vector NTI проверил это, когда выбирал линкер), а также в том, что не было найдено более простых путей для осуществления этого клонирования.

    Остальная информация в папке Design Description для нашей молекулы, вообще говоря, подобна описанию, которое мы получили, когда выполняли дизайн с pBR322 и pUC19. Однако, учитывая специфику задачи (концы реципиента идентичны), нам необходим какой-либо инструмент, чтобы различить клоны специфической ориентации. Vector NTI позаботился об этом, в папке Design Description появился новый раздел:

    Recommended enzyme(s) for restriction analysis
    defining clone with required fragment orientation:
      AvrII
      ApaLI
    

    Таким образом, для того чтобы разделить клоны по ориентации при помощи гель электрофореза нам следует использовать сайты рестрикции AvrII и ApaLI.

    Информацию из папки Design Description, так же как и любую другую информацию из текстовой панели можно вывести на печатающее устройство.

    Второй вариант: Сложный донор...

    Теперь разработаем новую молекулу, базирующуюся на фрагментах BPV1 и SV40, но в этом варианте усложним выбор донора, а не реципиента.

    Определим реципиент...

    Перейдем к Display window для BPV1 и вызовем Fragment Wizard. На первой панели Fragment Wizard выберем опцию Design recipient и нажмем на клавишу Next. На следующей панели укажем опцию "Set to a position" и введем 5000 в качестве координаты 5’-конца фрагмента. Нажмем на клавишу Next и перейдем к панели для определения 3’-конца фрагмента. Точно также как и для 5’ зададим координату 2500. Нажмем на клавишу Finish.

    Определение реципиента

    В появившемся окне проверим параметры выбранного фрагмента. Если все в порядке, добавим фрагмент к целевому списку, нажав для этого клавишу Add to List.

    Определим донор...

    Перейдем к окну SV40 и вызовем Fragment Wizard. Выберем опцию Design Donor. Нажмем на клавишу Next. Далее, кликнем на символе или на метке сигнала LARGE_T в графической части окна и за тем, нажмем на клавишу Next. По умолчанию на следующей панели нам предлагается оставить концы фрагмента неопределенными. Не будем ничего менять и снова нажмем на Next. Следующая диалоговая панель будет посвящена выбору фланкирующих участков.

    Здесь мы можем задать максимальный размер для фланкирующего участка или разрешить программе использовать все доступное пространство вне выбранного сигнала. Выберем опцию "Use flank region no larger than" (использовать фланкирующий участок не длиннее чем). Vector NTI предложит нам либо задать максимальную длину участка в соответствующем поле, либо выделить этот участок на графической панели. Переместим курсор к 5’-концу "проволочной рамки" (у символа 5’ форма курсора поменяется на перекрестие), теперь, удерживая клавишу мыши нажатой, переместим курсор (перетащим границу рамки) к позиции в районе нуклеотида 2250. Поле ввода на панели Fragment Wizard покажет максимальный размер фланкирующего участка (у нас должно получится что-то порядка 400 нуклеотидов). Когда мы закончим эту процедуру, перейдем к панели для 3’-конца фрагмента.

    На этой панели давайте попросим Vector NTI использовать рестрикционный сайт NcoI (в районе 38-го нуклеотида) для того, чтобы отрезать 3’-конец донор-фрагмента. Выберем опцию "Use specific site". Далее, нажав и удерживая клавишу Sift, кликнем на символе сайта NcoI у 38-го нуклеотида. Название и позиция сайта появятся на панели Fragment Wizard. Теперь нажмем на клавишу Finish и таким образом закончим определение донор-фрагмента.

    Определение донора

    Проверим параметры фрагмента в появившемся окне. Заметим, что 5’-конец описан как неопределенный вместе с заданной максимальной длиной фланкирующего участка, а 3’-конец установлен в сайте NcoI. Нажмем на клавишу Add to List – донор-фрагмент будет добавлен в целевой список молекулы.

    Проверим список фрагментов...

    Вызовем диалоговую панель Design Molecule и посмотрим на описание фрагментов. Реципиент-фрагмент должен находится вверху списка. Дважды кликнем на строке, соответствующей донор-фрагменту – откроется панель Fragment Editor. Один конец донор-фрагмента определен сайтом рестрикции, а другой содержит фланкирующий участок. Это в некоторой степени осложняет ситуацию с донором в сравнении с теми вариантами дизайна, которые мы прорабатывали ранее. Инвертируем донор и нажмем на клавишу ОК.

    Выполним дизайн...

    Введем все, что мы обычно вводим, когда создаем новую молекулу. Поменяем имя молекулы на "My Molecule 4". Установим опцию "Recipient’s Start". Это позволит Vector NTI, на сколько это возможно, определить начало новой молекулы в том же месте, где начинается молекула BPV1.

    Нажмем на клавишу Design в правом верхнем углу панели Design Molecule и запишем информацию о нашей молекуле в базу данных My base. Для продолжения нажмем на ОК. Оставим без изменения преференции и нажмем на клавишу Start Design. После некоторой паузы Vector NTI построит нам план дизайна и сформирует графическое представление новой молекулы.

    Посмотрим, что получилось...

    Представление новой молекулы

    Также как и в предыдущем варианте, папка Design Description содержит только одно вложение – Step #1. Обратим внимание, как усложненные условия отразились на описании процедуры дизайна. Vector NTI нашел достаточно простой и удобный путь для построения молекулы. Описание молекулы И донор и реципиент были изолированы при помощи сайтов NcoI и BamHI, при этом длина фланкирующего участка выдержана в соответствии с нашими ограничениями.

    Мы установили максимальную длину фланкирующего участка в 400 нуклеотидов. Выполняя наше условие Vector NTI нашел удобный сайт BamHI и сократил длину участка до 153 нуклеотидов.

    Если это необходимо, описание процесса дизайна и графическое изображение новой молекулы могут быть выведены на печатающее устройство.




Эти же материалы в формате MS Word можно забрать на сайте WETWARE;
"Практическая Молекулярная Биология" http://molbiol.edu.ru;
e-mail: pmb@molbiol.edu.ru


Rambler's Top100