на главную страницу
 > Обзоры > Vector NTI > Дизайн молекул.

Дизайн молекул.

Игорь Хмельков
Эти же материалы в формате MS Word можно забрать на сайте WETWARE.

    Для выполнения работ, описанных в данном разделе, необходимо уже иметь некоторый опыт "общения" с Vector NTI. Рекомендуется, как минимум, попробовать себя в конструировании молекул.

    Настоящий раздел описывает процедуру создания новой молекулы методом дизайна с помощью встроенной в Vector NTI базы биологических знаний (built-in biological knowledge). В процессе дизайна пользователь компилирует список фрагментов, описывающих целевую молекулу. Однако если сравнивать эту работу с конструированием, то здесь нет необходимости выбирать сайты рестрикции и методы модификации фрагментов. Все это за пользователя сделает Vector NTI. Используя встроенную базу знаний, программа сама построит план конструирования, оптимальный по выбору сайтов рестрикции и техники эксперимента.

    Для того, чтобы программа Vector NTI смогла разработать молекулу, необходимо в начале определить целевую молекулу в соответствующем списке (Goal List), как мы это делали при конструировании. В отличие от конструирования, описание молекулы должно содержать только фрагменты существующих молекул. Если потом понадобятся линкеры, адаптеры или другие фрагменты, Vector NTI добавит их самостоятельно.

    Занимаясь дизайном, мы можем, конечно, использовать "Редактор фрагментов" (Fragment Editor) для описания целевой молекулы, однако значительно более удобным будет обратиться для этих целей к "Мастеру фрагментов" (Fragment Wizard), доступному из Molecule Display window.

    Разрабатываемая молекула должна состоять из одного реципиент-фрагмента, который должен быть первым указан в списке целевой молекулы (или целевой список - Goal Molecule Definition List), и одного или нескольких донор-фрагментов.

    Реципиент-фрагмент является частью "родительской" молекулы (реципиент-молекулы). Каждый нуклеотид из реципиент-фрагмента будет включен в разрабатываемую молекулу. Vector NTI будет использовать всю оставшуюся часть родительской молекулы для того чтобы попытаться найти подходящие сайты рестрикции. Таким образом, нуклеотиды из родительской молекулы, не принадлежащие к реципиент-фрагменту, могут с некоторой вероятностью попасть и в целевую молекулу.

    Иногда может потребоваться указать специфический сайт рестрикции на одном или на каждом конце реципиент-фрагмента. Если тот или иной конец реципипент-фрагмента является рестрикционным сайтом, Vector NTI будет автоматически использовать этот сайт для дизайна новой молекулы. Мы можем попросить программу сохранить (или "потерять") такой сайт. Если мы не укажем в явном виде, что сайт следует сохранить, то он может и не попасть в окончательный вариант разрабатываемой молекулы.

    Все остальные фрагменты в списке являются донор-фрагментами. Задача донор-фрагмента привнести функциональные сигналы в реципиент. Поэтому, когда мы определяем донор-фрагменты, нам не следует описывать их в явном виде. Наоборот, необходимо лишь выбрать функциональные сигналы, которые должен содержать этот фрагмент. Это означает, что при выборе фрагмента мы должны указать на область функционального сигнала на изображении молекулы в Molecule Display window. Каждый нуклеотид из этой области будет включен в целевую молекулу, а нуклеотиды, расположенные в молекуле вне области функционального сигнала могут попасть, а могут и не попасть в целевую молекулу. Их судьбу решит Vector NTI.

    В дополнении к функциональным сигналам, донор-фрагмент может содержать фланкирующие участки. В процессе описания донор-фрагмента мы можем указать на один или несколько функциональных сигналов, в этом случае они попадут в выделенную на изображении молекулы область. Если теперь перетащить края выделенной области за пределы функциональных сигналов, мы получим фрагмент с группой функциональных сигналов плюс некоторое количество обрамляющих нуклеотидов. Это и есть фланкирующие участки. Vector NTI попробует сократить длину фланкирующего участка на сколько это возможно, если не встретит на участке рестрикционный сайт.

    В некоторых случаях бывает необходимо описать один или оба рестрикционных сайта, которые должны быть вырезаны из молекулы вместе с функциональными сигналами. Подобная работа - предмет отдельного разговора, выходящего за рамки данного раздела. А в этом разделе описывается процедура, когда для описания донора и реципиента требуется лишь минимальная информация.

    Сформулируем задачу...

    Итак, нам необходимо создать новую молекулу путем клонирования гена устойчивости к тетрациклину из плазмидной DNA pBR322 в pUC19. При этом мы полностью полагаемся на генно-инжереные знания Vector NTI.

    Приступим к определению целевой молекулы...

    В программе Vector NTI откроем Display window для pBR322 и pUC19. Как это сделать уже не раз описывалось в предыдущих разделах, и на этом мы останавливаться не будем.

    Используем pUC19 для определения реципиент-фрагмента, а pBR322 для донор-фрагмента.

    Определим реципиент-фрагмент...

    В качестве реципиент-фрагмента будет использована большая часть молекулы pUC19. Активируем графическую часть Display window для pUC19. Теперь нажмём на пиктограмму Add Fragment to Goal List.

    Откроется диалоговая панель Мастера фрагментов (Fragment Wizard). Мастер фрагментов должен быть уже знаком нам по практике конструирования молекул. Это последовательность диалоговых панелей, которые помогут шаг за шагом определить нужный фрагмент молекулы. Если мы сделаем ошибку на каком либо шаге, всегда можно будет вернуться назад, для этого предназначена клавиша Back. Как мы уже знаем, диалоговые панели Fragment wizard не являются модальными, их можно перемещать по экрану так, чтобы любая часть графического изображения молекулы была доступна для работы.

    На первой панели Fragment Wizard выберем опцию "Design Recipient Fragment" и нажмём на клавишу Next.

    Мастера фрагментов

    Следующая (вторая) панель поможет нам определить 5’-конец нового фрагмента. Выберем опцию "Set of position" и введем в поле значение 500. Нажмём на клавишу Next.

    На третьей панели определим 3’-конец фрагмента молекулы. Также как и в предыдущем случае выберем опцию "Set of position" и введем значение 200. Нажмём на клавишу Finish.

    Сообщение о новом фрагменте

    Появившееся в результате сообщение New Fragment будет содержать параметры нового фраг­мента. Если эти парамет­ры нас устраивают, нажмём на клавишу Add to List. Реципиент-фрагмент будет добавлен в список фрагментов целевой молекулы (Molecule Goal list).

    Реципиент-фрагмент, который мы выбрали, отображается в виде проволочной рамки на графическом изображении молекулы. Заметим, что полилинкер в районе двух часов (правый верхний угол) оказался за рамками выделенного фрагмента. Все нуклеотиды из выбранной зоны будут переданы в целевую молекулу без каких либо изменений. Если мы все-таки включим полилинкер в выделенную область, Vector NTI не сможет использовать в дальнейшем этот сайт в целях дизайна.

    Определим донора...

    Переключимся на панель Display window, содержащую информацию о pBR322. Активируем графическую часть окна (однократный клик в любом месте графической области) и нажмём на пиктограмму Add Fragment to Molecule Goal List. В результате появится панель Fragment Wizard.

    На первом экране выберем опцию "Design Donor Fragment" и нажмём клавишу Next. Второй экран позволит нам выбрать функциональные сигналы, которые будут переданы в реципиент-фрагмент. Если переместить курсор над графическим объектом или меткой, соответствующим какому-либо функциональному сигналу, курсор примет форму руки. В этот момент достаточно клика мышкой чтобы выбрать функциональный сигнал. Выберем таким способом TC(R), название сигнала тут же отобразится на панели Fragment Wizard.

    Следующие шаги во Fragment Wizard позволили бы нам определить фланкирующие участки, осложняющие и расширяющие процедуру дизайна, однако мы не будем на этом останавливаться т.к. это не входит в нашу задачу. Поэтому, нажмём на клавишу Finish. В этот раз будут использованы значения по умолчанию для того, чтобы доопределить наш фрагмент.

    Сообщение о новом фрагменте

    Обратим внимание, что в сообщении New Fragment 3’ и 5’ концы фрагмента описаны как неопределенные (Undefined). Нажмём на клавишу Add to List. Донор-фрагмент будет добавлен в список фрагментов целевой молекулы.



    Проверим целевой список...

    Открыть целевой лист

    Нажмём на пиктограмму Open Goal List в основной панели инструментов Vector NTI.

    В результате откроется диалоговая панель Design Molecule. Секция Component Fragments диалоговой панели содержит список фрагментов целевой молекулы (или целевой список). В данном случае список содержит два определенных нами фрагмента. Следует обратить внимание, что для реципиента концы фрагмента описываются позициями нуклеотидов. Для донора, концы фрагмента не определены (NODEF), зато имеются данные о том, что фрагмент должен содержать дескриптор TC(R).

    Заметим, что аналогичная панель используется при конструировании молекул, однако называется не Design Molecule, а Construct Molecule. Vector NTI понимает, что наши фрагменты предназначены для дизайна и выбирает соответствующий режим работы. Так, например, мы не сможем на этой стадии ни определить рестрикционные сайты, ни задать какую либо другую информацию, связанную с деталями клонирования – Vector NTI сам сформирует все детали, необходимые для корректного клонирования, что в конечном итоге позволит сэкономить наши усилия и сконцентрироваться на более серьезных задачах.

    Введем общую информацию о нашей молекуле...

    Поменяем название молекулы на "My Molecule2". Нажмём на клавишу General Info на панели Design Molecule. В появившемся окне введем общую информацию о создаваемой молекуле. В частности, в поле Description запишем "My molecule #2". Далее, в группе Replication Type установим опцию Plasmid. Установим флажок Bacteria в группе Extra-Chromosome Replication.

    Введем имя автора в качестве ключевого слова, выбрав его из раскрывающегося списка и нажав на клавишу Add. Если в списке нет нашего имени, его можно ввести прямо в поле списка, затем нажать на клавишу Add.

    Данные о новой молекуле

    Кликнем на ОК и вернемся к панели Design Molecule.

    Установим Start Position как Recipient’s Start. В этом случае начало новой молекулы совпадет с началом реципиент-фрагмента.

    Панель дизайна молекулы

    Подготовимся к дизайну...

    Нажмём на клавишу Design в правом верхнем углу панели Design Molecule. Vector NTI поинтересуется у нас по поводу базы данных в которую будет записан результат. Выберем базу "My base", которую мы создали, когда занимались конструированием молекул. Нажмём клавишу ОК.

    После того, как программа сохранит все введенные нами параметры новой молекулы, откроется диалоговая панель Design Parameters.

    Диалоговая панель параметров дизайна

    В списке REN Subbases необходимо выбрать группу эндонуклеаз рестрикции, данные о которых будут учтены Vector NTI в процессе дизайна. В качестве примера, мы сможем позднее создать базу данных по ферментам, которые имеются под рукой в нашей лаборатории, и предложить Vector NTI использовать только их для дизайна новой молекулы.

    Мы можем также определить системы трансформации, которые будут использованы в наших экспериментах, а также наличие или отсутствие возможностей экстра хромосомной репликации нашей молекулы в этих системах. Кроме этого, мы имеем возможность разрешить или запретить применение дефосфорилирования и т.п.

    Убедимся, что для нашего эксперимента выбрана база Palindromes/Non-Ambiguous. Оставим все прочие параметры без изменений.

    Установим предпочтения...

    Нажмём на клавишу Preferences. Откроется диалоговая панель Design Preferences. Это один из мощнейших инструментов программы. Он позволит нам установить ряд предпочтений для процесса дизайна. Мы сможем задать ограничения на использование программой Vector NTI той или иной техники генной инженерии. В частности, мы сможем установить предпочтения для техники изоляции фрагментов, их лигирования и модификации.

    Панель настроек

    Vector NTI может строить молекулу различными путями, в зависимости от того, как установлены предпочтения. Это дает нам несколько альтернатив для конструирования реальной молекулы.

    Попробуем изменить настройки для лигирования фрагментов. Выключим опцию для blunt-blunt-лигирования. Blunt-blunt-лигирование означает, что и донор и реципиент имеют только тупые концы (другими словами, не имеют липких концов). Раз мы деактивировали эту опцию, Vector NTI обеспечит наличие, по крайней мере, одного липкого конца у каждой молекулы.

    Оставим все остальные параметры без изменений. Нажмём на клавишу ОК.

    Приступим к дизайну...

    Наконец, целевая молекула и все параметры настройки определены. Теперь мы, и главное, Vector NTI, готовы выполнить дизайн. Нажмём на клавишу Start Design в правом верхнем углу панели Design Parameters. Vector NTI соберет необходимые данные и начнет создавать нашу молекулу. Система Vector NTI, базирующаяся на биологических знаниях, сгенерирует достаточное количество возможных путей клонирования донора в реципиент и выберет оптимальный с учетом наших предпочтений. В результате мы получим целевую молекулу.

    Обследуем новую молекулу...

    Новая молекула My Molecule2

    По окончании процесса дизайна новая молекула появится в Display window.

    Обратим внимание на графическое представление и текстовое описание новой молекулы. Самое интересное находится на панели текстового описания в папке Design Description. Такой папки не было ни у pBR322, ни у pUC19, ни когда мы занимались конструированием молекул. Это инструкция по созданию молекулы My Molecule2 в реальности, в рамках эксперимента по клонированию.


    Проинспектируем Design Plan...

    Описание клонирования

    Перейдем на текстовую панель и откроем папку Design Description. Внутри найдем папку Step #1, откроем и ее. Как мы сможем увидеть, Vector NTI выбрал для дизайна сайты SmaI и NarI у реципиента и BspDI и MluNI у донора. Программа выбрала совместимые сайта так, что не потребовалось выполнять биохимические операции для модификации концов фрагментов.

    Заметим, что с учетом выбранных сайтов, оба фрагмента имеют один липкий и один тупой конец, т.е., как мы и "просили", blunt-blunt-лигирование не использовалось. Донор-фрагмент имеет короткие фланкирующие участки, длиной менее чем в 200 нуклеотидов с каждой стороны области функционального сигнала TC(R).

    Перемещаясь вниз по содержимому папки мы увидим, что Vector NTI выбрал вариант клонирования при котором обеспечивается требуемая ориентация клонированного фрагмента в реципиенте. Следует также обратить внимание на то, что один из рестрикционных сайтов реципиента – SmaI – потерян после лигирования, допускающего предварительный отбор (преселекцию).

    Vector NTI определил сайты рестрикции для этого этапа клонирования так, чтобы минимизировать объем работ в реальном эксперименте. Вообще, Vector NTI выбирает подход к дизайну молекулы, опираясь кроме здравого смысла на следующие правила:

    • в первую очередь принимаются во внимание пользовательские предпочтения;
    • частичное расщепление (partial digestion) используется как можно меньше;
    • выбираются рестрикционные сайты, которые проще соединить и которые требуют минимальной (или вообще не требуют) обработки концов;
    • фрагменты вырезаются так, чтобы они были как можно короче.

    Вернемся к описанию процесса дизайна в папке Step #1. Как мы можем заметить, Vector NTI рекомендует нам преселекцию с использованием SmaI, при этом сайт SmaI у реципиента будет потерян в процессе бактериальной трансформации. Так как мы разрешили программе использовать только одну систему трансформации (бактериальную), у Vector NTI не было альтернатив. Если бы мы разрешили применение нескольких систем трансформации, Vector NTI выбрал бы систему, для работы с которой потребовалось бы меньше усилий.

    Vector NTI также рекомендует методику для анализа клона. В нашем случае рекомендован только один метод – рестрикционный анализ. В соответствии с рекомендациями программы необходимо использовать сайт EagI, который есть в рекомбинанте и отсутствует в реципиентной молекуле.

    Программа не рекомендует использовать гибридизацию колонии (colony gibridisation) для анализа клона. Однако, на тот случай если мы все-таки решим использовать этот метод, нам предлагается соответствующий олигонуклеотид. Кроме этого, рекомендуется ПЦР праймер на случай если мы решим использовать технику ПЦР для изоляции клонированного фрагмента из рекомбинантной молекулы.

    Наконец, Vector NTI перечисляет некоторые важные сайты рестрикции для новой молекулы. Это сайты, которые могут быть использованы для изоляции клонированного фрагмента из рекомбинанта. В нашем случае предлагается использовать NdeI и XbaI. Заметим, что программа использует эндонуклеазы рестрикции только из базы данных, которую мы выбрали в диалоговой панели Design Parameters.

    Далее, в Design Description перечислены сайты, которые отсутствуют в рекомбинанте (потеряны при клонировании) и сайты, которые являются уникальными для рекомбинантной молекулы. Перечень уникальных сайтов разбит на две группы. Одна группа описывает сайты, расположенные в рамках клонированного фрагмента, а другая – соответственно вне его.

    Если бы процесс дизайна содержал более чем один этап клонирования, соответствующая информация была бы представлена по каждому этапу и оформлена в отдельных папках.

    Распечатаем инструкцию...

    Финальный шаг в рамках нашей задачи – печать инструкции по дизайну новой молекулы, сгенерированной для нас программой Vector NTI. Сделаем активной текстовую панель Display window для нашей молекулы (можно кликнуть в любом месте текстовой панели, но, скорее всего она и так находится в активном состоянии). Закроем все папки в текстовой панели, далее откроем папку Design Description и вложенную папку Step #1.

    Кликнем на пиктограмме Print Active Pane. Открытые папки будут распечатаны на нашем принтере, и мы получим "твердую копию" плана по дизайну нашей молекулы:



    Design Description
    Step #1 
        Result Molecule: My Molecule2
        Recipient: pUC19
          Left Terminus: SmaI #1 (total 1) 
          Right Terminus: NarI #1 (total 1) 
          Full digestion 
        Donor: pBR322  
          Left Terminus: BspDI #1 (total 1) 
          Flank Region: 61 
          Right Terminus: MluNI #1 (total 1) 
          Flank Region: 170 
          Full digestion 
        Ligation: one blunt junction, one cohesive junction 
          Left recipient site lost after ligation 
        Required orientation achieved 
        Preselection: digestion by lost site(s) - SmaI 
        Transformation system: Bacteria 
        Extra-chromosomal replication 
        Recommended method(s) for clone analysis: 
          Restriction Analysis 
        Restriction analysis: 
          recombinant has new restriction site EagI 
        Recommended oligonucleotide for colony hybridization 
        of cloned fragment in resulting molecule: 
          CGATAAGCTTTAATGCGGTA 
        Recommended primers for PCR amplification 
        of cloned fragment in resulting molecule: 
        Sense Primer: 
          GGAGAAAATACCGCATCAGG
        Antisense Primer: 
          GTCGACTCTAGAGGATCCCC
        Important Restriction Sites: 
          Cloned fragment may be cut by NdeI and XbaI 
        Recombinant lacks sites of: 
          AatI Acc65I AccIII AflII AgeI ApaI 
          AscI AsuII AvrII BbrPI BclI BglII 
          BsiWI Bsp120I BspDI BsrGI BssHII Bst1107I 
          Ecl136II EcoRI HpaI KpnI KspI MfeI  
          MluI MluNI NcoI NotI NsiI PacI 
          PaeR7I PmeI Ppu10I SacI SmaI SnaBI 
          SpeI SwaI XmaI 
        Unique sites inside cloned fragment: 
          EagI EcoRV NheI NruI 
        Unique sites outside cloned fragment: 
          AatII NdeI PstI PvuI PvuII ScaI SspI XbaI 

Эти же материалы в формате MS Word можно забрать на сайте WETWARE;
"Практическая Молекулярная Биология" http://molbiol.edu.ru;
e-mail: pmb@molbiol.edu.ru


Rambler's Top100