на главную страницу
 > Обзоры > Vector NTI > Подбор праймеров и ПЦР.

ПЦР анализ при помощи Vector NTI.

Игорь Хмельков
Эти же материалы в формате MS Word можно забрать на сайте WETWARE.

    В данном разделе представлена методика ПЦР-анализа региона плазмиды ColE1. Работы по амплификации и анализу результатов выполняем в следующей последовательности:

    1. Выбираем регион для амплификации;
    2. Настраиваем параметры ПЦР симулятора;
    3. Выполняем ПЦР анализ, выбираем праймер;
    4. Анализируем праймер;
    5. Проводим ПЦР с выбранным праймером;
    6. Инспектируем результаты амплификации;
    7. Записываем результаты в базу данных;
    8. Настраиваем представление результатов амплификации.

    Итак, приступим...

    Запустим программу Vector NTI, Database Explorer откроется автоматически, если этого не происходит, его можно вызвать из панели инструментов, нажав на соответствующую пикторграмму.

    В Database Explorer откроем раздел базы данных, содержащий информацию по DNA/RNA молекулам (DNA/RNA Molecules (MAIN)), найдем строку с описанием ColE1 и откроем это описание (двойной клик вызовет Molecule Display window с информацией о плазмидной DNA).

    Выберем регион для амплификации...

    Кликнем мышкой в любом месте графической части Molecule Display window, описывающей ColE1. Эта часть окна станет активной. Теперь необходимо выделить регион 5200 – 6400. Выделение можно выполнить различными способами, например, открыть меню Edit и выбрать команду Set Selection. Далее, в появившемся окне задать границы фрагмента. Это окно можно вызвать также комбинацией клавиш Ctrl+G.

    Настроим параметры ПЦР-симулятора...

    Для того, чтобы подготовится к проведению реакции необходимо открыть меню Analyze и выбрать команду Primers... В результате появится диалоговое окно PCR Analysis:

    Диалоговое окно позволяет сделать следующее:

    • Автоматически подобрать соответствующие праймеры;
    • Задать праймеры собственноручно;
    • Добавить к 5’ или 3‘ концу продукта реакции короткую последовательность (не более 18 нп);
    • Сформулировать требования к гомологии праймера (Для определения требований к гомологии праймера необходимо нажать на клавишу Primer Homology, а в шестойверсии программы – Primer Similarity);
    • Задать биохимические и структурные параметры праймеров;
    • Определить требования к качеству праймеров.

    Основные параметры праймера задаются в диалоговом окне Primer/Oligo Parameters. К этому окну можно перейти, нажав на клавишу Primer Parameters. Обилие параметров, в которых на первый взгляд легко запутаться, компенсируется возможностью вызвать подсказку, нажав на клавишу F1.

    Кроме гомологии, структурных и биохимических параметров праймера можно задать требования к его качеству, для этого также предусмотрена отдельная диалоговая панель и соответствующая клавиша.

    Для описания качества праймеров введен целочисленный показатель значимости параметров (от 1 до 10, 10-максимальная значимость). Однако, оставим все параметры без изменений.

    Выполним ПЦР анализ...

    Если нажать на клавишу ОК в диалоговом окне Analysis, окно закроется, после чего Vector NTI запустит процедуру ПЦР-анализа. В текстовой части ColE1 Display window будет сформирована новая папка с результатами анализа.

    Посмотрим что в папке...

    Папка с результатами ПЦР-анализа содержит несколько подпапок, каждая из которых описывает один возможный вариант для амплификации фрагмента, длина которого находится в заданных нами пределах. Подпапки расположены в порядке убывания рейтинга (т.е. верхний вариант наиболее оптимален), а если рейтинг одинаков для всех вариантов, то в порядке возрастания длины фрагмента. Рейтинг рассчитывается на основе значимости параметров качества.

    В названии каждой подпапки находится номер варианта, длина и рейтинг продуктов реакции. Максимальный рейтинг – 171. Каждая подпапка содержит следующую информацию:

    • Координаты региона исходной молекулы в продукте реакции;
    • Температура плавления продукта реакции;
    • Оптимальная температура отжига для данной реакции;
    • Процентное содержание сочетания Гуанин-Цитозин (GC) в продукте реакции;
    • Две папки, описывающие прямой и обратный праймеры (комплементарность праймера целевой последовательности, последовательность в направлении 5’-3’, длина в нуклеотидах, температура плавления, содержание GC, энтальпия, энтропия и свободная энергия)
    • Последние строки в каждом варианте описывают различия в температуре плавления и содержании GC прямого и обратного праймеров.

    Обратим внимание на праймер...

    Из полученных нами на предыдущем шаге результатов выберем вариант с порядковым номером #1 (длина продукта 900 нп). Если соответствующая подпапка закрыта, ее можно открыть двойным кликом.

    Кликнем правой клавишей мыши на нуклеотидной последовательности прямого праймера для данного варианта:

    ACTCTTTTGAATGGTACTCC

    В появившемся меню выберем команду Analyze. В результате откроется окно Oligo Analisis. Оставим параметры для анализа олигомера без изменений и просто нажмем на клавишу Analyze. В результате получим:

    При нажатии на клавишу Dimers & Hairpin Loops, убедимся, что:

    1. Праймер имеет один участок, на котором образуется димер (GTAC/CATG);
    2. петли данным праймером не образуются.

    Нажимая на клавишу Close, последовательно закроем окна анализа олигомеров.

    Сохраним праймер в базу данных...

    Для того чтобы сохранить выбранный праймер в базу данных для последующей работы необходимо снова кликнуть правой клавишей мышки на последовательности праймера и в открывшемся меню выбрать команду Save To Database. При этом откроется панель New Oligo и вкладка General.

    В поле для имени олигомера введем "Sense primer – ColE1" и перейдем на вкладку Oligo. Поля на этой вкладке будут заполнены автоматически. Перейдем теперь на вкладку Keywords. В поле New Keyword впишем "_COLE1" нажмем клавишу Add. Можно использовать и имеющиеся в базе данных ключевые слова. Выберем из перечня "SENSE_PRIMER" и нажмем на клавишу Add. Теперь нажмем на клавишу OK, и наш праймер будет благополучно записан в базу данных под именем "Sense primer – ColE1" (Можно посмотреть Database Explorer в разделе Oligos).

    Продолжим работу с ПЦР...

    Сделаем активной графическую часть Display Window. Убедимся, что наш регион (5200 - 6400) все еще выделен, если нет, необходимо снова ввести его координаты (см. выше).

    Вызовем панель Analisis (через меню Edit). В появившейся панели загрузим прямой праймер, который мы получили на предыдущем этапе. Для этого нажмем на клавишу, расположенную справа от поля User-Defined Primers. В открывшемся окне выберем наш "Sense primer - ColE1".

    Если продукт ПЦР-реакции должен иметь на концах определенные сайты клонирования, необходимо выполнить соответствующие манипуляции с праймерами. Прикрепим сайт клонирования BamHI к 5’ концу прямого праймера. Для этого нажмем клавишу справа от поля "Attach to 5’ Terminus of Sense Primer". В открывшемся окне выберем базу Enzymes (MAIN) и соответствующий энзим (BamHI). Аналогичным образом добавим сайт HindIII на 5’ конец обратного праймера.

    Поставим флажок в поле Check Cloning Sites for Enzymes. В раскрывающемся списке выберем базу Palindromes/Non-Ambiguous.

    Теперь нажмем клавишу ОК, программа Vector NTI спросит, не хотим ли мы переписать текущие результаты ПЦР – ответим утвердительно.

    Посмотрим новые результаты...

    В результате ПЦР-анализа с новыми параметрами, получим уже знакомую нам структуру подпапок. Детальный анализ содержимого подпапок показывает, что:

    • во всех представленных вариантах используется наш прямой праймер, т.е. варианты различаются по последовательности обратного праймера;
    • к прямому и обратному праймерам добавлены сайты клонирования;
    • для каждого варианта (под параметром подобия – "Similarity" праймера) перечислены сайты клонирования. Энзимы рестрикции для этих сайтов взяты из указанной нами базы данных - Palindromes/Non-Ambiguous.
    • После названия энзима указывается количество вхождений. Если оно отсутствует, значит сайт найден только в последовательности праймера или в прикрепленной последовательности и отсутствует в продукте реакции.

    Запишем результаты реакции в базу данных...

    Предположим, что долгожданным продуктом нашей реакции является вариант с номером #1 (длиной 912 нп). Кликнем правой клавишей мышки на названии продукта и в открывшемся меню выберем команду Save to Database and Create Window. Откроется диалоговое окно, в котором следует ввести информацию о новой молекуле. На вкладке General в поле введем название продукта "My product 1", затем нажмем клавишу ОК.

    <
     

    В результате получим Molecule Display Window с информацией о нашей молекуле:


     

    Оформляем результаты...

    Сделаем активной текстовую панель Molecule Display Window. Кликнем на пиктограмме Link Panes (см. рисунок выше). Учитывая, что все папки текстовой панели свернут, вся информация, представленная на графической панели будет скрыта. Теперь последовательно открывая папки текстовой панели, будем "высвечивать" те или иные параметры на графическом изображении молекулы.

     

     

     

    Активируем графическую панель. Оперируя пиктограммами Standard Arrangement, Zoom In, Zoom Out можно добиться желаемой детальности изображения. Хорошие результаты получаются при масштабировании изображения (с помощью пиктограмм) при нажатой клавише Ctrl.


Эти же материалы в формате MS Word можно забрать на сайте WETWARE;
"Практическая Молекулярная Биология" http://molbiol.edu.ru;
e-mail: pmb@molbiol.edu.ru


Rambler's Top100